Question: Turn Off Blast Search On Reverse Complement Strand In Blastn
1
gravatar for Zhaorong
10.7 years ago by
Zhaorong30
State College, PA
Zhaorong30 wrote:

I have a quick question: How can I turn off search on reverse complement strand of my query nucleotide sequence in blastn?

For example, I don't want 'GUAAAGCCAAAUCUUCGGUUA' to be a hit when I use 'UAACCGAAGAUUUGGCUUUAC' as the query.

Maybe I missed it when I read the man page, but I really appreciate it if someone can point out the parameter I should use.

Thanks!

sequence blast • 1.3k views
ADD COMMENTlink modified 10.7 years ago by Jane ♦♦ 0 • written 10.7 years ago by Zhaorong30
1
gravatar for István Albert
10.7 years ago by
István Albert ♦♦ 310
University Park
István Albert ♦♦ 310 wrote:

The -S flag can select the strands:

-S  Query strands to search against database 
    (for blast[nx], and tblastx) 3 is both, 1 is top, 2 is bottom [Integer]
ADD COMMENTlink written 10.7 years ago by István Albert ♦♦ 310
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 2 users visited in the last hour