Question: (Closed) Computing The Reverse And Complement Of A Sequence With Pygr
1
gravatar for Question Bot
10.7 years ago by
Question Bot90
Question Bot90 wrote:

Computing the reverse complement with the Pygr bioinformatics framework:

#
# Reverse complement example with pygr
#

from pygr.sequence import Sequence

# needs a separate function to reverse strings
def rev(it):
    "Reverses an interable and returns it as a string"
    return ''.join(reversed(it))

# original sequence as as string
seq = 'ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG'

# create a Sequence class  instance named bobo
dna = Sequence(seq,'bobo')

# sequence class' type and content
print type(dna)
print dna

# the -operator reverse complements the DNA, returns a new sequence
print -dna

# to reverse the DNA, reverse the input data
rdna = Sequence( rev(seq),'bobo')
print rdna

# to complement the DNA reverse complement, then reverse again
cseq = rev(str(-dna))
cdna = Sequence(cseq,'bobo')

print cdna

Produces the output:

<class 'pygr.sequence.Sequence'>
ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG
CTATCGGGCACCCTTTCAGCGGCCCATTACAATGGCCAT
GATAGCCCGTGGGAAAGTCGCCGGGTAATGTTACCGGTA
TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC
sequence python pygr use • 1.2k views
ADD COMMENTlink modified 10.6 years ago by Jane ♦♦ 0 • written 10.7 years ago by Question Bot90
Please log in to add an answer.
The thread is closed. No new answers may be added.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 2 users visited in the last hour