User: Zhaorong

gravatar for Zhaorong
Zhaorong30
Reputation:
30
Status:
New User
Location:
State College, PA
Last seen:
8 years, 11 months ago
Joined:
11 years ago
Email:
1*@lvh.me

A grad student in bioinformatics studying plant small RNAs.

Posts by Zhaorong

<prev • 3 results • page 1 of 1 • next >
2
votes
1
answer
1.3k
views
16 follow
1
answer
Turn Off Blast Search On Reverse Complement Strand In Blastn
... I have a quick question: How can I turn off search on reverse complement strand of my query nucleotide sequence in blastn? For example, I don't want 'GUAAAGCCAAAUCUUCGGUUA' to be a hit when I use 'UAACCGAAGAUUUGGCUUUAC' as the query. Maybe I missed it when I read the man page, but I really appreci ...
sequence blast written 10.7 years ago by Zhaorong30 • updated 10.7 years ago by Jane ♦♦ 0
4
votes
2
answers
986
views
24 follow
2
answers
How To Set Shrimp Parameters For Best Sensitivity With 35Bp Colorspace Data?
... Hi, I have 35bp Solid colorspace sequencing data, and the actual sequences to be mapped are 20-25bp after removing the linker sequence. I hope to find all the hits allowing no more than n mismatches (say n=3), not only the best hit. I know there is a -M option to specify -M sensitivity,35bp. I wo ...
shrimp sequencing short aligner written 10.9 years ago by Zhaorong30 • updated 10.9 years ago by Gue Su Chang10
1
vote
5
answers
1.2k
views
5
answers
Answer: A: Site Use Guidelines
... Hi, I don't think a new user can vote on a question or an answer. The site says I need 15 reputation... ...
written 11.0 years ago by Zhaorong30 • updated 11.0 years ago by Gue Su Chang10

Latest awards to Zhaorong

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 1 users visited in the last hour