User: Suk211

gravatar for Suk211
Suk21160
Reputation:
60
Status:
New User
Location:
state college
Website:
http://twitter.com/suk211
Last seen:
9 years, 3 months ago
Joined:
11 years ago
Email:
8@lvh.me

interested systems biology,protein folding ,genomics

Posts by Suk211

<prev • 3 results • page 1 of 1 • next >
2
votes
6
answers
1.5k
views
6
answers
Answer: A: What Is The Best Way To Share Scripts Between Members Of A Lab?
... This might be useful . A Quick Guide to Organizing Computational Biology Projects ...
written 10.6 years ago by Suk21160 • updated 10.6 years ago by Tom Koerber30
4
votes
3
answers
1.3k
views
3
answers
Answer: A: Where Can I Get The Secondary Structure Of A Protein?
... If you have the PDB file then you can use the standard tool called DSSP , it is supposed to be the gold standard for obtaining secondary structure. In case you just have sequence then I personally prefer PSIPRED , it takes evolutionary information into account to predict the secondary structure . Ac ...
written 10.7 years ago by Suk21160 • updated 10.7 years ago by Tom Koerber30
0
votes
5
answers
818
views
5
answers
Answer: A: Finding Common Motifs In Sequences
... ACGGGCCCGACGATGCGTCGTA ACGTACGTCGAACCGTCGTCGT ACGTGCGTCGAAACGTCAGTCG ACGGGTTCGATCGTCGTCGTCG may be in Python I will break down the first sequence of required motif length into a sliding window and will search for those list of motifs in the rest of sequences using regular expression in python ...
written 11.1 years ago by Suk21160 • updated 11.1 years ago by Jane ♦♦ 0

Latest awards to Suk211

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 0 users visited in the last hour